Stem-loop sequence ame-mir-9868

AccessionMI0031794 (change log)
DescriptionApis mellifera miR-9868 stem-loop
Stem-loop
   u    gauaa          -         u  c     ugcucu 
5'  cggc     aagcucggcg uuucaucga gc uggcc      u
    ||||     |||||||||| ||||||||| || |||||       
3'  gccg     uuugggcugc gaaguagcu cg auugg      u
   g    ----a          u         -  a     ugcccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 4319827-4319912 [-]
intergenic
Database links

Mature sequence ame-miR-9868-3p

Accession MIMAT0037272
Sequence

55 - 

uuaagcucgaugaagucgucgg

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).