Stem-loop sequence ame-mir-9870

AccessionMI0031796 (change log)
DescriptionApis mellifera miR-9870 stem-loop
Stem-loop
   -            --a  a     u            uu 
5'  cgugcacacgug   cg cgccg cacguacgugcg  c
    ||||||||||||   || ||||| ||||||||||||  a
3'  gcgcgugugcac   gc gcggc gugugugcgcgu  a
   u            gug  g     -            gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000063.5: 3155081-3155157 [+]
intergenic
Database links

Mature sequence ame-miR-9870-5p

Accession MIMAT0037274
Sequence

11 - 

ugacgacgccgucacguacgugc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).