Stem-loop sequence ame-mir-9872

AccessionMI0031798 (change log)
DescriptionApis mellifera miR-9872 stem-loop
Stem-loop
   uaug   c   a    a ag           -----------------    caa 
5'     aga gaa cgag c  agauagaacga                 gaga   u
       ||| ||| |||| |  |||||||||||                 ||||    
3'     ucu cuu gcuc g  ucuaucuugcu                 cucu   u
   gcaa   a   c    c cu           gcaacgcaauauacuau    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 99803-99897 [-]
intergenic
Database links

Mature sequence ame-miR-9872-5p

Accession MIMAT0037276
Sequence

11 - 

aacgagacagagauagaacga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).