Stem-loop sequence ame-mir-9873

AccessionMI0031799 (change log)
DescriptionApis mellifera miR-9873 stem-loop
Stem-loop
   a      c                  aa        cc  c 
5'  cgccag uaauccgaggcugcggca  gauaauuc  ga g
    |||||| ||||||||||||||||||  ||||||||  || u
3'  gcgguu auuagguuucggcgucgu  uuauuagg  cu a
   -      u                  --        ac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 2167518-2167599 [+]
intergenic
Database links

Mature sequence ame-miR-9873-3p

Accession MIMAT0037277
Sequence

51 - 

gauuauuugcugcggcuuugga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).