Stem-loop sequence ame-mir-9874

AccessionMI0031800 (change log)
DescriptionApis mellifera miR-9874 stem-loop
Stem-loop
   c    ---aaa   gaa     u              -   --c    cu 
5'  gaua      gua   uccuu gcucgucgugggac gag   aacg  c
    ||||      |||   ||||| |||||||||||||| |||   ||||  g
3'  cuau      cau   aggaa cgggcagcaccuug cuc   uugc  a
   u    gcaaag   --a     -              u   acc    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 11985759-11985852 [-]
intergenic
Database links

Mature sequence ame-miR-9874-5p

Accession MIMAT0037278
Sequence

11 - 

agaauccuuugcucgucguggga

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).