Stem-loop sequence ame-mir-9875

AccessionMI0031801 (change log)
DescriptionApis mellifera miR-9875 stem-loop
Stem-loop
   a     aca g g        guaa  a    g -   agaa 
5'  aggga   c u uucucucu    uu cguc c cga    a
    |||||   | | ||||||||    || |||| | |||    g
3'  ucccu   g g aggaggga    ga guag g gcu    a
   g     -ga - g        --ag  -    g u   auau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 5204391-5204471 [-]
intergenic
Database links

Mature sequence ame-miR-9875-3p

Accession MIMAT0037279
Sequence

51 - 

gugggaugaggaagggaggag

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).