Stem-loop sequence ame-mir-9877

AccessionMI0031803 (change log)
DescriptionApis mellifera miR-9877 stem-loop
Stem-loop
   g     ug  a       ug ----     aa   aaa 
5'  ccgug  ug ggucguu  u    uguuu  uag   g
    |||||  || |||||||  |    |||||  |||    
3'  gguau  au ucggcgg  g    acagg  guc   g
   -     gu  g       gu gguc     gc   ggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 971375-971447 [-]
intergenic
GL634195.1: 11327-11399 [+]
intergenic
Database links

Mature sequence ame-miR-9877-3p

Accession MIMAT0037281
Sequence

42 - 

gcgggacacugggugggcggcu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).