Stem-loop sequence ame-mir-9878

AccessionMI0031804 (change log)
DescriptionApis mellifera miR-9878 stem-loop
Stem-loop
   -uaaaaaua   -a       cca       g    -u   u 
5'          ucu  aauagau   aacaucc aaua  cug a
            |||  |||||||   ||||||| ||||  |||  
3'          aga  uugucua   uuguagg uuau  gau a
   cgugggcuc   cg       -ag       g    uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 7528176-7528257 [+]
intergenic
Database links

Mature sequence ame-miR-9878-3p

Accession MIMAT0037282
Sequence

51 - 

ugggauguugaaucuguugcag

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).