Stem-loop sequence ame-mir-9880

AccessionMI0031806 (change log)
DescriptionApis mellifera miR-9880 stem-loop
Stem-loop
   a    g   gaaaac      c u  gc          a   ccu   cg 
5'  ucga ggu      gcucca c cg  gaaagccgau cga   cgc  g
    |||| |||      |||||| | ||  |||||||||| |||   |||   
3'  ggcu uua      uggggu g gc  cuuucggcua guu   gcg  c
   c    g   ------      a -  ua          c   -uu   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 21635109-21635202 [+]
intergenic
Database links

Mature sequence ame-miR-9880-3p

Accession MIMAT0037284
Sequence

64 - 

aucggcuuucaucggaugggg

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).