Stem-loop sequence ame-mir-9881

AccessionMI0031807 (change log)
DescriptionApis mellifera miR-9881 stem-loop
Stem-loop
   uaau    c u   u          aa    --aa    g 
5'     gccg g acg cgcguuucga  ggga    ccga a
       |||| | ||| ||||||||||  ||||    |||| a
3'     cggc c ugc gcgugaagcu  cccu    ggcu u
   uguu    u u   c          -c    auug    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 2097058-2097137 [+]
intergenic
Database links

Mature sequence ame-miR-9881-5p

Accession MIMAT0037285
Sequence

11 - 

uacgucgcguuucgaaaggga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).