Stem-loop sequence ame-mir-9884

AccessionMI0031810 (change log)
DescriptionApis mellifera miR-9884 stem-loop
Stem-loop
   cc  -     uca u     a     g    -   gcucucg   gc 
5'   uc cguuu   g gcuuc gucgc cgac gac       gac  u
     || |||||   | ||||| ||||| |||| |||       |||   
3'   ag gcaaa   c cgaag cagug gcug cug       cug  u
   au  u     -cc u     -     -    g   ------a   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 8330580-8330664 [-]
intergenic
Database links

Mature sequence ame-miR-9884-3p

Accession MIMAT0037288
Sequence

55 - 

ucggucggugacgaagcuccc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).