Stem-loop sequence ame-mir-9885

AccessionMI0031811 (change log)
DescriptionApis mellifera miR-9885 stem-loop
Stem-loop
   -               a         c      --  uu u 
5'  ucggcucgacucggc augaucgga gugguc  gg  c g
    ||||||||||||||| ||||||||| ||||||  ||  |  
3'  agccgagcugagccg uauuagccu uaccag  cc  g u
   a               c         u      ag  uc a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 10781860-10781940 [+]
intergenic
Database links

Mature sequence ame-miR-9885-5p

Accession MIMAT0037289
Sequence

11 - 

ucggcaaugaucggacgugguc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).