Stem-loop sequence ame-mir-9886

AccessionMI0031812 (change log)
DescriptionApis mellifera miR-9886 stem-loop
Stem-loop
   g    c       c   ug   g c u     c  g ggu 
5'  uccu gucgucg uuc  caa g g cgccu cg g   g
    |||| ||||||| |||  ||| | | ||||| || |   g
3'  agga cagcggc aag  guu c c gcgga gc u   a
   -    c       -   gu   g a u     u  g ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 4021827-4021907 [-]
intergenic
Database links

Mature sequence ame-miR-9886-3p

Accession MIMAT0037290
Sequence

51 - 

uaggcgucacguuguggaacg

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).