Stem-loop sequence ame-mir-9887

AccessionMI0031813 (change log)
DescriptionApis mellifera miR-9887 stem-loop
Stem-loop
   g      aa  --a      -      g   -  aa      ggu 
5'  gagaag  ga   gggcug ggaagg cgg ag  ggcgaa   g
    ||||||  ||   |||||| |||||| ||| ||  ||||||   g
3'  uuuuuc  cu   ccuggc ccuuuu guc uu  uugcuu   c
   a      -a  gcg      u      a   a  aa      ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000064.5: 2661272-2661359 [+]
intergenic
Database links

Mature sequence ame-miR-9887-5p

Accession MIMAT0037291
Sequence

11 - 

aagggcugggaagggcggag

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).