Stem-loop sequence ame-mir-9890

AccessionMI0031817 (change log)
DescriptionApis mellifera miR-9890 stem-loop
Stem-loop
   a       u   c         u    a      uau 
5'  uuuuucu uuu ggaagaaug agag aaaaga   a
    ||||||| ||| ||||||||| |||| ||||||   c
3'  agaaagg aaa ucuucuugc uuuc uuuucu   a
   a       c   u         -    c      uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 5084273-5084348 [+]
intergenic
Database links

Mature sequence ame-miR-9890-5p

Accession MIMAT0037295
Sequence

11 - 

uucggaagaauguagagaaaaag

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).