Stem-loop sequence ame-mir-9892

AccessionMI0031819 (change log)
DescriptionApis mellifera miR-9892 stem-loop
Stem-loop
   a       ggcugc        a  --uu   u  c    uuca 
5'  auaccga      cucgauuu cu    ucg cg caag    a
    |||||||      |||||||| ||    ||| || ||||    a
3'  uaugguu      gagcuaaa gg    agc gc guuc    u
   c       ------        -  uguu   -  a    uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 4378353-4378433 [+]
intergenic
Database links

Mature sequence ame-miR-9892-3p

Accession MIMAT0037297
Sequence

52 - 

ugacgcgauuguggaaaucg

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).