Stem-loop sequence ame-mir-9893

AccessionMI0031820 (change log)
DescriptionApis mellifera miR-9893 stem-loop
Stem-loop
   auuucuagu         -    aua        -    gau 
5'          uuuaugauc ugga   cuagguuc auaa   u
            ||||||||| ||||   |||||||| ||||   a
3'          aagugcuag accu   gauuuaag uauu   a
   guaauaauu         g    cua        a    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL633872.1: 1388-1472 [-]
intergenic
Database links

Mature sequence ame-miR-9893-5p

Accession MIMAT0037298
Sequence

11 - 

uuaugaucuggaauacuagg

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).