Stem-loop sequence pal-mir-3958

AccessionMI0032339 (change log)
DescriptionPteropus alecto miR-3958 stem-loop
Stem-loop
   --      u     au         uug 
5'   agguug ccgug  guauuugcu   u
     |||||| |||||  |||||||||    
3'   ucuagu ggcac  uauagacgg   u
   uc      u     gu         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22080829-22080884 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-3958
pal-mir-323KB031153.1: 22071163-22071218 [+]
pal-mir-758KB031153.1: 22071453-22071510 [+]
pal-mir-329bKB031153.1: 22072221-22072280 [+]
pal-mir-543KB031153.1: 22077011-22077068 [+]
pal-mir-495KB031153.1: 22078847-22078904 [+]
pal-mir-3958KB031153.1: 22080829-22080884 [+]
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
Database links

Mature sequence pal-miR-3958-5p

Accession MIMAT0039807
Sequence

1 - 

agguuguccgugauguauuugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-3958-3p

Accession MIMAT0039808
Sequence

35 - 

agauauugcacgguugaucucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).