Stem-loop sequence pal-mir-487b

AccessionMI0032451 (change log)
DescriptionPteropus alecto miR-487b stem-loop
Stem-loop
   --    uuau      c u     uuuua 
5'   gugg    cccugu c guucg     c
     ||||    |||||| | |||||      
3'   cacc    gggaca g uaagc     u
   uu    uacu      u c     uguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22088954-22089011 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-487b
pal-mir-3958KB031153.1: 22080829-22080884 [+]
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
Database links

Mature sequence pal-miR-487b-5p

Accession MIMAT0040019
Sequence

1 - 

gugguuaucccuguccuguucg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-487b-3p

Accession MIMAT0040020
Sequence

37 - 

aaucguacagggucauccacuu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).