Stem-loop sequence pal-mir-544

AccessionMI0032553 (change log)
DescriptionPteropus alecto miR-544 stem-loop
Stem-loop
   -u           -     u   -ga  c 
5'   cuuguuaaaag gcaga ucu   uu a
     ||||||||||| ||||| |||   ||  
3'   gaacgauuuuu cgucu aga   ag g
   uu           a     u   acc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22091066-22091122 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-544
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
Database links

Mature sequence pal-miR-544-5p

Accession MIMAT0040211
Sequence

1 - 

ucuuguuaaaaggcagauucu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-544-3p

Accession MIMAT0040212
Sequence

37 - 

auucugcauuuuuagcaaguu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).