Stem-loop sequence pal-mir-3959

AccessionMI0032554 (change log)
DescriptionPteropus alecto miR-3959 stem-loop
Stem-loop
   --g  u      aga         uua 
5'    gu gaucag   acauacauu   u
      || ||||||   |||||||||    
3'    ca cuaguc   uguauguag   c
   uga  c      aac         uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22093968-22094021 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-3959
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
Database links

Mature sequence pal-miR-3959-5p

Accession MIMAT0040213
Sequence

1 - 

gguugaucagagaacauacauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-3959-3p

Accession MIMAT0040214
Sequence

33 - 

uguaugucaacugauccacagu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).