Stem-loop sequence pal-mir-889

AccessionMI0032561 (change log)
DescriptionPteropus alecto miR-889 stem-loop
Stem-loop
   --     c      uagua     u  aua 
5'   aaugg uguccg     ugguc cu   u
     ||||| ||||||     ||||| ||    
3'   uuacc acaggc     auuag ga   u
   ug     a      -uaua     u  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22090283-22090341 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-889
pal-mir-3958KB031153.1: 22080829-22080884 [+]
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
Database links

Mature sequence pal-miR-889-5p

Accession MIMAT0040226
Sequence

1 - 

aauggcuguccguaguaugguc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-889-3p

Accession MIMAT0040227
Sequence

39 - 

uuaauaucggacaaccauugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).