Stem-loop sequence bta-mir-10161

AccessionMI0032913 (change log)
DescriptionBos taurus miR-10161 stem-loop
Stem-loop
   guau    cugu      a     -           uuc    cagu 
5'     uagu    ggaguc gacau acugagugacu   acuu    u
       ||||    |||||| ||||| |||||||||||   ||||     
3'     aucg    ucucag cugug ugacucacuga   ugaa    c
   cccc    --uu      c     c           -cu    uuga 
Get sequence
Deep sequencing
637 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 14152823-14152914 [+]
intergenic
Database links

Mature sequence bta-miR-10161-5p

Accession MIMAT0040908
Sequence

11 - 

guggagucagacauacugaguga

 - 33

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).