Stem-loop sequence bta-mir-10162

AccessionMI0032914 (change log)
DescriptionBos taurus miR-10162 stem-loop
Stem-loop
   -        a        g     cc    u  a  c gc 
5'  ccccauag guggacag ccaag  gcug gc gg a  u
    |||||||| |||||||| |||||  |||| || || |   
3'  gggguguu cgccuguc gguuc  cggc cg cc u  c
   g        c        g     -u    -  a  c ac 
Get sequence
Deep sequencing
112 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 87296602-87296680 [+]
intergenic
Database links

Mature sequence bta-miR-10162-5p

Accession MIMAT0040909
Sequence

11 - 

uggacaggccaagccgcugugca

 - 33

Get sequence
Deep sequencing100 reads, 22 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).