Stem-loop sequence bta-mir-10165

AccessionMI0032917 (change log)
DescriptionBos taurus miR-10165 stem-loop
Stem-loop
   ug   -   --a a    --       ac    --a      agag 
5'   ucc cug   g gccu  gcaggug  gagg   caccac    a
     ||| |||   | ||||  |||||||  ||||   ||||||     
3'   agg ggc   c cgga  cgucuac  cucc   guggug    c
   ua   a   cac c    ga       ga    acg      aagg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 44237590-44237676 [-]
intergenic
Database links

Mature sequence bta-miR-10165-5p

Accession MIMAT0040912
Sequence

11 - 

agccugcaggugacgaggacac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).