Stem-loop sequence bta-mir-507

AccessionMI0032920 (change log)
DescriptionBos taurus miR-507 stem-loop
Stem-loop
   g     ug   cc           u     u    cu gc 
5'  ugugc  uac  cauuccaaggc ugcca ucau  g  u
    |||||  |||  ||||||||||| ||||| ||||  |   
3'  acaug  aug  guaagguucug acggu agug  c  a
   -     ca   aa           u     u    uu aa 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 30495820-30495900 [-]
intergenic
Database links

Mature sequence bta-miR-507-3p

Accession MIMAT0040915
Sequence

51 - 

auuggcaugucuuggaaugaa

 - 71

Get sequence
Deep sequencing61 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).