Stem-loop sequence bta-mir-10168

AccessionMI0032921 (change log)
DescriptionBos taurus miR-10168 stem-loop
Stem-loop
   -    u  ca    ---    c   gg        --ua   cuc 
5'  aggc gg  gucu   gagg agu  aaacagag    gcu   u
    |||| ||  ||||   |||| |||  ||||||||    |||    
3'  uccg cc  uaga   cucc ucg  uuugucuc    cga   c
   g    -  ua    cgg    c   --        uacc   cuc 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 62254671-62254753 [+]
intergenic
Database links

Mature sequence bta-miR-10168-5p

Accession MIMAT0040916
Sequence

11 - 

ucugaggcaguggaaacagagua

 - 33

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).