Stem-loop sequence bta-mir-10170

AccessionMI0032923 (change log)
DescriptionBos taurus miR-10170 stem-loop
Stem-loop
   - -     a   a      ca    c         aag  a 
5'  c cccgc cuc ccggcg  gcgg ugaccuggg   gc c
    | ||||| ||| ||||||  |||| |||||||||   ||  
3'  g gggcg gag ggcugc  ugcc auugggccc   cg u
   g c     a   a      ac    -         ---  g 
Get sequence
Deep sequencing
6 reads, 16.7 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 38167200-38167277 [-]
intergenic
Database links

Mature sequence bta-miR-10170-5p

Accession MIMAT0040918
Sequence

11 - 

accggcgcagcggcugaccugg

 - 32

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).