Stem-loop sequence bta-mir-10171

AccessionMI0032924 (change log)
DescriptionBos taurus miR-10171 stem-loop
Stem-loop
   uuugcucccugucccuuuggcaucccugucuuaagca     c           aagg 
5'                                      gcagc cuuuuuccacc    a
                                        ||||| |||||||||||    g
3'                                      cgucg ggagaaggugg    a
   ------------------------gggugaggguuga     a           guau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 43149822-43149916 [-]
intergenic
Database links

Mature sequence bta-miR-10171-3p

Accession MIMAT0040919
Sequence

64 - 

uggguggaagaggagcugcagu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).