Stem-loop sequence bta-mir-10172

AccessionMI0032925 (change log)
DescriptionBos taurus miR-10172 stem-loop
Stem-loop
   --cu   g         c          a    uuaaaucca 
5'     gcc gaugaagua aggaugccca ugaa         u
       ||| ||||||||| |||||||||| ||||          
3'     cgg uuauuucgu uccuacgggu acuu         c
   ccgu   g         c          c    uacauaaau 
Get sequence
Deep sequencing
523 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67369583-67369666 [-]
intergenic
Database links

Mature sequence bta-miR-10172-5p

Accession MIMAT0040920
Sequence

11 - 

aaguacaggaugcccaaugaau

 - 32

Get sequence
Deep sequencing35 reads, 24 experiments
Evidence experimental; Illumina [1]

Mature sequence bta-miR-10172-3p

Accession MIMAT0040921
Sequence

53 - 

ucacugggcauccucugcuuua

 - 74

Get sequence
Deep sequencing488 reads, 63 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).