Stem-loop sequence bta-mir-10173

AccessionMI0032926 (change log)
DescriptionBos taurus miR-10173 stem-loop
Stem-loop
   --------------------ggggcgag     aagu   g     g   gagcug     ga 
5'                             ggagg    gag aagga cca      cagcu  a
                               |||||    ||| ||||| |||      |||||   
3'                             ccucc    cuc uuccu ggu      gucga  a
   accuuguucgagggcuuagaccuccaca     ----   g     a   -----a     gu 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 48935334-48935432 [-]
intergenic
Database links

Mature sequence bta-miR-10173-5p

Accession MIMAT0040922
Sequence

11 - 

aggaagugaggaaggagccaga

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).