Stem-loop sequence bta-mir-10174

AccessionMI0032930 (change log)
DescriptionBos taurus miR-10174 stem-loop
Stem-loop
   -  -   c   u   --          -  c      gugacu 
5'  uc ugg ugc ugg  guuccuggca ug ugauuu      u
    || ||| ||| |||  |||||||||| || ||||||       
3'  ag acc acg acc  uagggaccgu ac acuaaa      a
   c  c   a   c   au          u  -      auuaga 
Get sequence
Deep sequencing
188523 reads, 1.48e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 83483597-83483678 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-10174
bta-mir-2475chr8: 83482947-83483017 [+]
bta-mir-10174chr8: 83483597-83483678 [+]
bta-mir-27bchr8: 83483816-83483912 [+]
bta-mir-24-1chr8: 83484370-83484437 [+]
Database links

Mature sequence bta-miR-10174-5p

Accession MIMAT0040927
Sequence

11 - 

uggguuccuggcaugcugauuu

 - 32

Get sequence
Deep sequencing3934 reads, 19 experiments
Evidence experimental; Illumina [1]

Mature sequence bta-miR-10174-3p

Accession MIMAT0040928
Sequence

49 - 

aucacauugccagggauuaccacg

 - 72

Get sequence
Deep sequencing184586 reads, 78 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).