Stem-loop sequence bta-mir-10176

AccessionMI0032932 (change log)
DescriptionBos taurus miR-10176 stem-loop
Stem-loop
   gaa    a  a  a   -ga     g      uuggaa 
5'    ggug gg gg gga   gagcu caaguu      u
      |||| || || |||   ||||| ||||||       
3'    ccac cc cc ccu   cucgg guucaa      u
   uuc    c  a  c   aug     g      ugugug 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 131743604-131743680 [+]
intergenic
Database links

Mature sequence bta-miR-10176-5p

Accession MIMAT0040931
Sequence

11 - 

aggaggagagagcugcaaguu

 - 31

Get sequence
Deep sequencing16 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).