Stem-loop sequence bta-mir-10179

AccessionMI0032938 (change log)
DescriptionBos taurus miR-10179 stem-loop
Stem-loop
   a   -   --gg     --    gu       u u     aug 
5'  gag ugg    gucug  cagg  gguaggc g gggcu   u
    ||| |||    |||||  ||||  ||||||| | |||||   g
3'  uuc acc    cggac  gucc  ccguccg c cccgg   g
   c   u   ggua     cu    ac       c c     agu 
Get sequence
Deep sequencing
20 reads, 7.69 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 51608539-51608622 [+]
intergenic
Database links

Mature sequence bta-miR-10179-5p

Accession MIMAT0040937
Sequence

11 - 

ucugcagggugguaggcugugg

 - 32

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).