Stem-loop sequence bta-mir-10181

AccessionMI0032940 (change log)
DescriptionBos taurus miR-10181 stem-loop
Stem-loop
   -  ----      -------a   ug -    ga   -   -    u   aa 
5'  gg    gcaucg        cug  g gaag  gcu gug cugg aga  g
    ||    ||||||        |||  | ||||  ||| ||| |||| |||  g
3'  cc    uguagc        gac  c cuuc  ugg cac gacc ucu  g
   a  guug      gaccccug   gu u    uc   u   u    -   cg 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 130167949-130168039 [-]
intergenic
Database links

Mature sequence bta-miR-10181-5p

Accession MIMAT0040939
Sequence

11 - 

ugugggaaggagcugugcugg

 - 31

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).