Stem-loop sequence bta-mir-10184

AccessionMI0032943 (change log)
DescriptionBos taurus miR-10184 stem-loop
Stem-loop
   g             c                      a  aa 
5'  guaccuaccccca uggguuuucuacauuaaaaagu ua  u
    ||||||||||||| |||||||||||||||||||||| ||  u
3'  cauggaugggggu acccaaaagauguaauuuuuca au  a
   -             a                      a  aa 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 66632872-66632957 [-]
intergenic
Database links

Mature sequence bta-miR-10184-3p

Accession MIMAT0040943
Sequence

55 - 

uuuaauguagaaaacccaaugg

 - 76

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).