Stem-loop sequence bta-mir-10185

AccessionMI0032944 (change log)
DescriptionBos taurus miR-10185 stem-loop
Stem-loop
   uguaa   - c    a  ga   a   -a  c   u 
5'      gag c gcgg gg  gcg gcg  gc ggc a
        ||| | |||| ||  ||| |||  || ||| g
3'      cuc g cgcc cc  cgc cgc  cg ccg a
   cgagc   c c    g  ac   -   cg  a   g 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 57118517-57118588 [-]
intergenic
Database links

Mature sequence bta-miR-10185-5p

Accession MIMAT0040944
Sequence

11 - 

gcggagggagcgagcgagccgg

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).