Stem-loop sequence gma-MIR10197

AccessionMI0032964 (change log)
DescriptionGlycine max miR10197 stem-loop
Stem-loop 
   aaaa    -  a           c        u                u 
5'     gaua ac uuuuagaacga uuuuuccu uaaccggucuaaaagg u
       |||| || ||||||||||| |||||||| ||||||||||||||||  
3'     uuau ug aaaaucuugcu aaaaagga auugguuagauuuucc a
   uuua    a  a           a        u                a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 33086656-33086756 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR10197
gma-MIR2111achr1: 33084345-33084452 [+]
gma-MIR10197chr1: 33086656-33086756 [+]
Database links

Mature sequence gma-miR10197

Accession MIMAT0040964
Sequence

11 -  

auuuuagaacgacuuuuuccu

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).
2
PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).