Stem-loop sequence hsa-mir-10226

AccessionMI0033056 (change log)
DescriptionHomo sapiens miR-10226 stem-loop
Stem-loop
   -      -  -   c    g   g  c   ga   u 
5'  gaggga ac uuc augu ucu gg ugg  aac g
    |||||| || ||| |||| ||| || |||  |||  
3'  cuuccu ug gag uaca agg uc acc  uug g
   u      a  u   u    g   g  -   uc   a 
Get sequence
Deep sequencing
20 reads, 169 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48032882-48032951 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-10226
hsa-mir-10226chr17: 48032882-48032951 [+]
hsa-mir-152chr17: 48037161-48037247 [-]
Database links

Mature sequence hsa-miR-10226

Accession MIMAT0041128
Sequence

11 - 

ccaugugucugggcugggaaac

 - 32

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25182173 "Identification and characterization of novel serum microRNA candidates from deep sequencing in cervical cancer patients" Juan L, Tong HL, Zhang P, Guo G, Wang Z, Wen X, Dong Z, Tian YP Sci Rep. 4:6277(2014).