Stem-loop sequence ssc-mir-10383

AccessionMI0033393 (change log)
DescriptionSus scrofa miR-10383 stem-loop
Stem-loop
         a        ug        g   uuc     
5' gcccac gccagggc  caggcacu aca   accc 
   |||||| ||||||||  |||||||| |||   ||| a
3' cgggug cgguucug  guccgugg ugu   uggu 
         a        ca        -   -ua     
Get sequence
Deep sequencing
31 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf4309: 1747-1817 [-]
intergenic
Database links

Mature sequence ssc-miR-10383

Accession MIMAT0041591
Sequence

46 - 

uggugccugacgucuuggcagu

 - 67

Get sequence
Deep sequencing26 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).