Stem-loop sequence ssc-mir-10384-1

AccessionMI0033394 (change log)
DescriptionSus scrofa miR-10384-1 stem-loop
Stem-loop
         g        cu        -    uu 
5' gccccu cguggcuu  cugugcag ucuu  c
   |||||| ||||||||  |||||||| ||||  u
3' cgggga gcaccgga  gacacguc aggg  u
         g        ag        c    uc 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 88902990-88903055 [+]
intergenic
Database links

Mature sequence ssc-miR-10384

Accession MIMAT0041592
Sequence

3 - 

cccugcguggcuucucugugca

 - 24

Get sequence
Deep sequencing84 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).