Stem-loop sequence ssc-mir-1842

AccessionMI0033396 (change log)
DescriptionSus scrofa miR-1842 stem-loop
Stem-loop
       g   uu     g g    u  g      g  g  a      ac   
5' gccu ggg  cugau u gcgg gg caacgu ag gc gccagc  cu 
   |||| |||  ||||| | |||| || |||||| || || ||||||  | g
3' ugga cuc  ggcug a cguc uc guugca uc ug ugguug  gu 
       a   --     g g    -  g      g  g  g      ga   
Get sequence
Deep sequencing
46 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 42401522-42401617 [-]
intergenic
Database links

Mature sequence ssc-miR-1842

Accession MIMAT0041594
Sequence

71 - 

uuggcucugcgaggucggcu

 - 90

Get sequence
Deep sequencing46 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).