Stem-loop sequence ssc-mir-10386

AccessionMI0033399 (change log)
DescriptionSus scrofa miR-10386 stem-loop
Stem-loop
           ---            u    u 
5' cccgucgu   ccucucccuccc ccuc c
   ||||||||   |||||||||||| ||||  
3' gggcggcg   ggggggggaggg ggag c
           ccc            -    g 
Get sequence
Deep sequencing
991 reads, 108 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 870325-870380 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-10386
ssc-mir-10386chr6: 870325-870380 [-]
ssc-mir-9816chr6: 860751-860833 [+]
Database links

Mature sequence ssc-miR-10386

Accession MIMAT0041598
Sequence

4 - 

gucguccucucccucccuccu

 - 24

Get sequence
Deep sequencing24 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).