Stem-loop sequence ssc-mir-10388

AccessionMI0033401 (change log)
DescriptionSus scrofa miR-10388 stem-loop
Stem-loop
   c          ga           -       
5'  acaacucugg  aguaccauuua gauaug 
    ||||||||||  ||||||||||| ||||| c
3'  uguugggacc  ucgugguaagu uuauau 
   -          --           g       
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 53138319-53138377 [+]
intergenic
Database links

Mature sequence ssc-miR-10388

Accession MIMAT0041600
Sequence

1 - 

cacaacucugggaaguaccauuu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).