Stem-loop sequence ssc-mir-10389

AccessionMI0033403 (change log)
DescriptionSus scrofa miR-10389 stem-loop
Stem-loop
         ug      ---   --  cc     ---    ug --   u ga 
5' aagugc  gcacuu   gga  ag  uggcc   gucc  a  gcc g  a
   ||||||  ||||||   |||  ||  |||||   ||||  |  ||| |   
3' uucacg  cgugaa   ccu  uc  accgg   uagg  u  cgg c  g
         gu      ggu   ag  cu     ucu    gu ca   u au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr8: 78935970-78936061 [+]
intergenic
chr8: 78936048-78936139 [+]
intergenic
Database links

Mature sequence ssc-miR-10389

Accession MIMAT0041602
Sequence

1 - 

aagugcuggcacuuggaagccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).