Stem-loop sequence ssc-mir-10390

AccessionMI0033404 (change log)
DescriptionSus scrofa miR-10390 stem-loop
Stem-loop
           acu           accugaacacaaccuuuuuugaucc 
5' acuauacu   gacagaccgca                         a
   ||||||||   |||||||||||                         g
3' ugauauga   uuguuuggugu                         c
           --g           uucuguagccgugggacauggugga 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 5427130-5427224 [-]
intergenic
Database links

Mature sequence ssc-miR-10390

Accession MIMAT0041603
Sequence

4 - 

auacuacugacagaccgcaaccu

 - 26

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).