Stem-loop sequence ssc-mir-10391

AccessionMI0033405 (change log)
DescriptionSus scrofa miR-10391 stem-loop
Stem-loop
   ---  -  c       a    auuggucuuguaaaccagaaaagga 
5'    gg gu aguuuuc uuuc                         g
      || || ||||||| ||||                          
3'    cc ca ucagagg aagg                         g
   ccg  u  a       -    aacuccgaaucccuccugcacagga 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 146643947-146644035 [+]
intergenic
Database links

Mature sequence ssc-miR-10391

Accession MIMAT0041604
Sequence

68 - 

aaggaaggagacuaacuccgcc

 - 89

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).