Stem-loop sequence ssc-mir-6516

AccessionMI0033411 (change log)
DescriptionSus scrofa miR-6516 stem-loop
Stem-loop
         aa         a  g ug   a    cu   a 
5' guuuug  uuugcagua ca g  uga cauu  agc g
   ||||||  ||||||||| || |  ||| ||||  |||  
3' caaaac  aaacgucau gu u  acu guag  uug c
         --         a  a gu   a    -u   a 
Get sequence
Deep sequencing
345 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 4273963-4274037 [+]
intergenic
Database links

Mature sequence ssc-miR-6516

Accession MIMAT0041610
Sequence

50 - 

aucauguaugauacugcaaaca

 - 71

Get sequence
Deep sequencing244 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).