Stem-loop sequence egr-mir-277b

AccessionMI0033524 (change log)
DescriptionEchinococcus granulosus miR-277b stem-loop
Literature search

2 open access papers mention egr-mir-277b
(14 sentences)

Stem-loop
   --a        --      g      acg  accc 
5'    gaccagau  uuugca uuuaua   cu    a
      ||||||||  |||||| ||||||   ||     
3'    uuggucua  aaacgu aaauau   ga    c
   gua        ua      -      -ga  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000012.1: 779202-779267 [+]
intergenic
Database links

Mature sequence egr-miR-277b-5p

Accession MIMAT0041734
Sequence

1 - 

agaccagauuuugcaguuua

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-277b-3p

Accession MIMAT0041735
Sequence

44 - 

uaaaugcaaaauaucugguuaug

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).