Stem-loop sequence sly-MIR10531

AccessionMI0033691 (change log)
DescriptionSolanum lycopersicum miR10531 stem-loop
Stem-loop
   --    c        u              u         g        u   aguaa   u 
5'   auau uggggucc aguagagucgguuc acauugggu uuaagugu uug     uca c
     |||| |||||||| |||||||||||||| ||||||||| |||||||| |||     |||  
3'   uaua accuuagg ucaucucagucaag uguaaccca aauucaua aau     agu a
   gc    a        c              u         a        c   --gaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 35003064-35003185 [+]
intergenic
Database links

Mature sequence sly-miR10531

Accession MIMAT0042017
Sequence

6 - 

ugggguccuaguagagucgguuc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1